DREB1A, JQ086361.1-DREB1A.m1 (mRNA) Malus sieversii

Unique NameJQ086361.1-DREB1A.m1
OrganismMalus sieversii ()

This mRNA is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
DREB1ADREB1AMalus sieversiigene

The following CDS feature(s) are a part of this mRNA:

Feature NameUnique NameSpeciesType
JQ086361.1-DREB1A.m1-cds1JQ086361.1-DREB1A.m1-cds1Malus sieversiiCDS

The following polypeptide feature(s) derives from this mRNA:

Feature NameUnique NameSpeciesType
DREB1AJQ086361.1-DREB1A.p1Malus sieversiipolypeptide

This mRNA is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI Rosaceae gene and mRNA sequences2014-12-31
Feature NameTypeLocationAnalysis
JQ086361 region JQ086361:1..711+ NCBI Rosaceae gene and mRNA sequences
Chr06 chromosome Chr06:17755036..17755746- Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Cross References
External references for this mRNA
The following sequences are available for this feature:

mRNA sequence

>JQ086361.1-DREB1A.m1 ID=JQ086361.1-DREB1A.m1|Name=DREB1A|organism=Malus sieversii|type=mRNA|length=711bp
back to top

protein sequence of DREB1A

>JQ086361.1-DREB1A.p1 ID=JQ086361.1-DREB1A.p1|Name=DREB1A|organism=Malus sieversii|type=polypeptide|length=236bp
back to top

mRNA from alignment at JQ086361:1..711+

Legend: CDS
Hold the cursor over a type above to highlight its positions in the sequence below.
>JQ086361.1-DREB1A.m1 ID=JQ086361.1-DREB1A.m1|Name=DREB1A|organism=Malus sieversii|type=mRNA|length=711bp|location=Sequence derived from alignment at JQ086361:1..711+ (Malus sieversii)
atgaatacgatcttcagtactcaactctccgattcctccgaaaagcccga atcgagttccgacgacacaagcatcacggctcaaagccagctggcttcct tctccgacgaggaggtcattttggcgtccagccggcctaagaagcgagcg gggaggagagttttcaaggagacgaggcacccagtttacagaggagttag gaggaggaacaacaacaagtgggtgtgcgaaatgagggaaccaaacaaga agaagtcgaggatatggctcggaacttatccgacggccgagatggcagct cgggcgcatgacgtggcggcattggcctttagagggaagcttgcctgcct caattttgcagactccgcatggcgcctgcctgttccggcatccattgatt cagtggatatcagacgggccgctgcggaggctgcagagacgttccggcca gcggagtttggcggagtgttggaaagcggcgatgatgagaaggagagcaa gaaaatggaggaggagaaggattgtggaggcgtggagggaagtggaatct tgttttacttggatgaggaggaaatgttcgacatgccaaggttgctggat agtatggcggaagggcttctgctctctccgcctcactcttcaggtggcta catgaactgggatgacatgggaagcaatgatgacgtcagtctgtggagct tctcaaattga
back to top

Coding sequence (CDS) from alignment at JQ086361:1..711+

>JQ086361.1-DREB1A.m1 ID=JQ086361.1-DREB1A.m1|Name=DREB1A|organism=Malus sieversii|type=CDS|length=711bp|location=Sequence derived from alignment at JQ086361:1..711+ (Malus sieversii)
back to top