green point, qGP10.X3263xBr-ch3 (QTL) Malus domestica

QTL Overview


QTL Label	qGP.X3263xBr-ch3.1
Published Symbol	GP10
Trait Name	date of green point
Trait Alias	N/A
Trait Study	Apple bud phenology traits-Celton-2011
Population	X3263_x_Belrene-F1
Female Parent	X3263
Male Parent	Belrene
Colocalizing Marker	GDsnp00194
Neighboring Marker	N/A
Environment	N/A
LOD	4.72
Additivity Dominance Ratio	N/A
R2	0.1
Comments	N/A

Publications


Year	Publication
2011	Celton J, Martinez S, Jammes M, Bechti A, Salvi S, Legave J, Costes E. Deciphering the genetic determinism of bud phenology in apple progenies: a new insight into chilling and heat requirement effects on flowering dates and positional candidate genes. New phytologist. 2011; 192(2):378-392.

Map Positions


#	Map Name	Linkage Group	Bin	Chromosome	Peak	Span Start	Span Stop	MapViewer
1	Apple-X3263xBr-F1	3	N/A	N/A	31	-	-	View

Alignments

Feature Name	Type	Location	Analysis
Chr03	chromosome	Chr03:10012517..10012617.	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation

Sequences

The following sequences are available for this feature:

QTL from alignment at Chr03:10012517..10012617

QTL from alignment at Chr03:10012517..10012617

Legend: genetic_marker

Hold the cursor over a type above to highlight its positions in the sequence below.

>qGP.X3263xBr-ch3.1 ID=qGP.X3263xBr-ch3.1; Name=date of green point; organism=Malus x domestica; type=QTL; length=101bp; location=Sequence derived from: Chr03:10012517..10012617 (Malus x domestica
TTGTACCATATTCATGTTCGTGTCAAAAAAATGAGCTACACAACCGCTAG
TTTCATGAGTACAAACCTTATTATGATGTCGTGTCGTAAATTGTCACACT
T