harvest date, qHD.RB-B14.Motueka-2010 (QTL) Malus x domestica

QTL Overview
QTL LabelqHD.RB-B14.Motueka-2010
Published SymbolN/A
Trait Nameharvest date
Trait AliasN/A
Trait StudyApple-Envirnonmental_Interaction_Phenotypes-Tustin-2014
PopulationBraeburn
Female ParentDelicious
Male ParentUP_Braeburn
Colocalizing MarkerGDsnp00453
Neighboring MarkerN/A
EnvironmentN/A
LOD3.89
Additivity Dominance RatioN/A
R28
CommentsN/A
Map Positions
#Map NameLinkage GroupBinChromosomePeakSpan StartSpan StopMapViewer
1Apple-B-F1-2014B14N/AN/A26--View
Alignments
Feature NameTypeLocationAnalysis
Chr14 chromosome Chr14:24746579..24746679. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
MDC000289.686 contig MDC000289.686:22319..22319. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Sequences
The following sequences are available for this feature:

QTL from alignment at Chr14:24746579..24746679

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qHD.RB-B14.Motueka-2010 ID=qHD.RB-B14.Motueka-2010; Name=harvest date; organism=Malus x domestica; type=QTL; length=101bp; location=Sequence derived from: Chr14:24746579..24746679 (Malus x domestica
AGGAAAGAGTAAATAATCCAATAGGCAAGCCACTGCTGATCATCTAGTTT GGATGTGCTCTCTATGGCTACCACTGATGCATATCTACACTCAAATCATA T
back to top

QTL from alignment at MDC000289.686:22319..22319

Legend: genetic_marker
Hold the cursor over a type above to highlight its positions in the sequence below.
>qHD.RB-B14.Motueka-2010 ID=qHD.RB-B14.Motueka-2010; Name=harvest date; organism=Malus x domestica; type=QTL; length=1bp; location=Sequence derived from: MDC000289.686:22319..22319 (Malus x domestica
R
back to top