Hi05b09, Hi05b09 (genetic_marker) Malus x domestica

Marker Overview
NameHi05b09
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1Hi05b09.primer 1: AAACCCAACCCAAAGAGTGG
Primer 2Hi05b09.primer 2: GTTTCTAACGTGCGCCTAACGTG
Product Length136-144
PolymorphismP_ Hi05b09
Publication[view all]
ContactA. Patocchi
Andreas Peil
Miyuki Kunihisa
E. Silfverberg-Dilworth
Publications
YearPublication
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
E. Silfverberg-Dilworth
First name:E.
Last name:Silfverberg-Dilworth
Institution:Swiss Federal Institute of Technology
Address:Plant Pathology, Institute of Plant Science, Swiss Federal Institute of Technology, ETH Zurich, Switzerland
Country:Switzerland
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi05b09.primer 1Malus x domesticaprimer
primer 2Hi05b09.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
resistance to Erwinia amylovoraqREA.O3R5-ch7.2-R5Malus x domesticaQTL
phenolic compound contentqPHE.X5210X8402-LG7.J09.procyanidinB5Malus x domesticaQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
length of the longest internode of the trunkqINLmaxT.SG-ch7Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi05b09_SGHi05b09_SGMalus x domesticamarker_locus
Hi05b09Hi05b09Malus x domesticamarker_locus
Hi05b09pHi05b09p-51Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-SG-F17N/A61Hi05b09_SGView
2Apple-C16xC17-F1-20127N/A67.89Hi05b09View
3Apple-FD-F1-2006F7N/A64.8Hi05b09View
4Apple-IM-F1-Mr5Mr5 LG 7N/A73.4Hi05b09View
5Apple-MAL0045_x_Idared-F1-MfuscaLG7aN/A47Hi05b09View
6Apple-MM-F17N/A71.5Hi05b09View
7Apple-OA-F1-AkaneAK7N/A73Hi05b09View
8Apple-M432-2012LG7N/A69.2Hi05b09View
9Apple-RGTxGD-F1-2015RGT_7N/A44.66Hi05b09View
10Apple-X5210X8402-F1-X8402LG7N/A79.2Hi05b09View
11Apple-JM7xS63-F1J7N/A51Hi05b09pView