Hi02b10, Hi02b10 (genetic_marker) Malus x domestica

Marker Overview
NameHi02b10
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1Hi02b10.primer 1: TGTCTCAAGAACACAGCTATCACC
Primer 2Hi02b10.primer 2: GTTTCTTGGAGGCAGTAGTGCAG
Product Length200-254
PolymorphismP_ Hi02b10
Publication[view all]
ContactA. Patocchi
Miyuki Kunihisa
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1Hi02b10.primer 1Malus x domesticaprimer
primer 2Hi02b10.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Hi02b10Hi02b10Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-FD-F1-2006D16N/A44.9Hi02b10View
2Apple-OA-F1-OrinOR1N/A0Hi02b10View
3Apple-OA-F1-AkaneAK1N/A0Hi02b10View
4Apple-FjxPL-F1-2013LG1N/A0Hi02b10View
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop