Hi21c08, Hi21c08 (genetic_marker) Malus x domestica

Marker Overview
NameHi21c08
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifCTT
PCR Conditionannealing temp 60 degree
Primer 1Hi21c08.primer 1: TTCTTCTCCTCCACCACCTC
Primer 2Hi21c08.primer 2: GTTTGTCACTGAGAAGGCGGTAGC
Product Length227-230
PolymorphismP_ Hi21c08
Publication[view all]
ContactA. Patocchi
Contact
NameDetails
A. Patocchi
First name:Andrea
Last name:Patocchi
Institution:Agroscope Changins-W?denswil Research Station ACW
Address:Standort W?denswil Schloss Postfach 185 8820 W?denswil
Country:SWITZERLAND
Email:andrea.patocchi@acw.admin.ch
Phone:+41 44 783 6313
Fax:+41 (0)44 783 63 05
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map5N/A72.5Hi21c08View
2Apple-FD-F1-2006D5N/A49.3Hi21c08View
3Apple-JM7xS63-F1J5N/A58.1Hi21c08View