NZmsEB117266, NZmsEB117266 (genetic_marker) Malus x domestica

Marker Overview
NameNZmsEB117266
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(CA)11
Primer 1NZmsEB117266.F: CATCCATGATCATTCAAGACC
Primer 2NZmsEB117266.R: CGTGGCCCTCTATATTAAAGC
Publication[view all]
ContactAndreas Peil
S. Gardiner
Contact
NameDetails
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
S. Gardiner
First name:Sue
Last name:Gardiner
Institution:HortResearch, New Zealand
Address:HortResearch Palmerston North Tennent Drive Private Bag 11 030 Palmerston North, New Zealand
Email:sgardiner@hortresearch.co.nz
Phone:64-6-356 8080
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit shapeqFRSH.JGD-G15.1.2009.2Malus x domesticaQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
FNZmsEB117266.FMalus x domesticaprimer
RNZmsEB117266.RMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NZmsEB117266NZmsEB117266Malus x domesticamarker_locus
NZmsEB117266NZmsEB117266-132.22Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-IM-F1-IdaredIda LG 15N/A57.8NZmsEB117266View
2Apple-IM-F1-Mr5Mr5 LG 15N/A22.7NZmsEB117266View
3Apple-MM-F115N/A83NZmsEB117266View
4Apple-GDxJ-F1-2012LG15N/A77.6NZmsEB117266View
5Apple-M432-2012LG15N/A85.6NZmsEB117266View
6Apple-JGD-F1-2014G15N/A51.2NZmsEB117266View
7Pear-integrated_consensus_map-IPCG-2017LG15N/A132.22NZmsEB117266View