s1_1238680, s1_1238680 (genetic_marker) Prunus avium

Marker Overview
Names1_1238680
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:s1_1238680
TypeSNP
SNP AllelesT/C
5' Flanking SequenceCTGCCGGCAAGCTCTTTCGCACATCTCTCGGTCTGGACTCCGGATGCATTGCTCA
3' Flanking SequenceGGCACGGC
SpeciesPrunus avium
Publication[view all]
ContactStijn Vanderzande
Patricio Hinrichsen
Commentsweet cherry SNPs identified by GBS from Guajardo et al (2015), unmapped - intergenic SNPs
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
s1_1238680s1_1238680Prunus aviummarker_locus


Sequence
>s1_1238680 ID=s1_1238680|Name=s1_1238680|organism=Prunus avium|type=genetic_marker|length=64bp
CTGCCGGCAAGCTCTTTCGCACATCTCTCGGTCTGGACTCCGGATGCATT
GCTCAYGGCACGGC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet Cherry-RosBREED-3.8K-20201N/A4.94s1_1238680View
2Sweet Cherry-RaxRi-F1LG1N/A8.17s1_1238680View
3Sweet_cherry_RaxRi_F1-physical-Prunus-persicaV1.0scaffold 1N/A1238680s1_1238680View
Alignments
Feature NameTypeLocationAnalysis
PAV_r1.0chr1 chromosome PAV_r1.0chr1:1276856... Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)
Pp01 chromosome Pp01:1238490... Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
Contact
NameDetails
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Patricio Hinrichsen
First name:Patricio
Last name:Hinrichsen
Title:Investigator, R&D SubDirector
Institution:Instituto de Investigaciones Agropecuarias (INIA) La Platina
Address:Santa Rosa 11610, La Pintana
Country:Chile
Email:phinrichsen@inia.cl
Phone:56 2 25779101
Fax:56 2 25779104
Keywords:Plant genetics and breeding