|
Marker Overview
Name | SAmsEB138859 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | (TCCC) 7.5 |
Primer 1 | SAmsEB138859.Forward Primer: TACGCTAGTGCTACAGAAGC |
Primer 2 | SAmsEB138859.Reverse Primer: AAACTCCATAGCAGTAGTTCG |
Max Length | 454 |
Publication | [view all] |
Contact | Felicidad Fernandez-Fernandez
|
Alignments
The following features are aligned
Publications
Year | Publication |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
2012 | Fernández-Fernández F, Antanaviciute L, van Dyk MM, Tobutt KR, Evans KM, Rees DJG, Dunwell JM, Sargent DJ. A genetic linkage map of an apple rootstock progeny anchored to the Malus genome sequence. Tree genetics & genomes. 2012; 8(5):991-1002. |
|