|
Marker Overview
Name | GA2ox |
Genbank ID | N/A |
Type | candidate gene marker |
Species | Prunus avium |
Primer 1 | isGA2ox.Forward: TTTTGGACAGAACCCAGAAGA |
Primer 2 | isGA2ox.Reverse: CTGTGCCTCACACTTTGGAA |
Publication | [view all] |
Comment | peach homologue was located on the peach genome sequence and then located into the sweet cherry map using flanking markers |
Alignments
The following features are aligned
|