|
|
Marker Overview
| Name | GA2ox |
|---|
| Genbank ID | N/A |
|---|
| Type | candidate gene marker |
|---|
| Species | Prunus avium |
|---|
| Primer 1 | isGA2ox.Forward: TTTTGGACAGAACCCAGAAGA |
|---|
| Primer 2 | isGA2ox.Reverse: CTGTGCCTCACACTTTGGAA |
|---|
| Publication | [view all] |
|---|
| Comment | peach homologue was located on the peach genome sequence and then located into the sweet cherry map using flanking markers |
|---|
Alignments
The following features are aligned
|
