7_95068, 7_95068 (genetic_marker) Fragaria iinumae

Marker Overview
Name7_95068
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
7_950687_95068Fragaria iinumaemarker_locus
7_950687_95068-35.977Fragaria iinumaemarker_locus


Sequence
>7_95068 ID=7_95068|Name=7_95068|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CTGTTCTCTGCCCAACTCAGTTCCTTGCAAGYTACTTCCATGTTCATAGC
TTCTTCCTCTAAAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A35.987_95068View
2Fragaria-Fii5N/A35.987_95068-35.977View