TP3307, TP3307 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP3307
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP3307TP3307Fragaria iinumaemarker_locus
TP3307TP3307-43.264Fragaria iinumaemarker_locus


Sequence
>TP3307 ID=TP3307|Name=TP3307|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCAGCAAGAGCCTTGATGACAATGCCATACGTGTAGGCATTTGGTT
CCACCCCAGAAACC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A43.26TP3307View
2Fragaria-Fii5N/A43.26TP3307-43.264View