3_981481, 3_981481 (genetic_marker) Fragaria iinumae

Marker Overview
Name3_981481
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
3_9814813_981481Fragaria iinumaemarker_locus
3_9814813_981481-44.713Fragaria iinumaemarker_locus


Sequence
>3_981481 ID=3_981481|Name=3_981481|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CATTTCCAAAACATGAGCTTTTTGTTTTCGGYTTTTTGCTACCACTCAAG
TGATATAGATTCTA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A44.713_981481View
2Fragaria-Fii5N/A44.713_981481-44.713View