s6_8151697, s6_8151697 (genetic_marker) Prunus avium

Marker Overview
Names6_8151697
dbSNP IDN/A
SNP Array ID
Cherry 6+9K SNP array:s6_8151697
TypeSNP
SNP AllelesA/G
5' Flanking SequenceAGAATCTACTAGCTAGAGAGATTAAATGCAATTATTAGCATTTGGGTGAGACTGCCT
3' Flanking SequenceATGCAG
SpeciesPrunus avium
Publication[view all]
ContactPatricio Hinrichsen
Stijn Vanderzande
Commentsweet cherry SNPs identified by GBS from Guajardo et al (2015), unmapped - intragenic SNPs
Contact
NameDetails
Patricio Hinrichsen
First name:Patricio
Last name:Hinrichsen
Title:Investigator, R&D SubDirector
Institution:Instituto de Investigaciones Agropecuarias (INIA) La Platina
Address:Santa Rosa 11610, La Pintana
Country:Chile
Email:phinrichsen@inia.cl
Phone:56 2 25779101
Fax:56 2 25779104
Keywords:Plant genetics and breeding
Stijn Vanderzande
First name:Stijn
Last name:Vanderzande
Address:Laboratory for Fruit Breeding and Biotechnology - Willem de Croylaan 42 - B-3001 Heverlee - Belgium
Country:Belgium
Email:stijn.vanderzande@wsu.edu
Libraries
Library NameType
Cherry 6+9K SNP arraySNP_chip
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
s6_8151697s6_8151697Prunus aviummarker_locus


Sequence
>s6_8151697 ID=s6_8151697|Name=s6_8151697|organism=Prunus avium|type=genetic_marker|length=64bp
AGAATCTACTAGCTAGAGAGATTAAATGCAATTATTAGCATTTGGGTGAG
ACTGCCTRATGCAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Sweet_cherry_RaxRi_F1-physical-Prunus-persicaV1.0scaffold 6N/A8151697s6_8151697View
2Sweet Cherry-RosBREED-3.8K-20206N/A28.33s6_8151697View
Alignments
Feature NameTypeLocationAnalysis
Pp06 chromosome Pp06:8166228..8166228. Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)
PAV_r1.0chr6 chromosome PAV_r1.0chr6:7922511..7922511. Prunus avium Whole Genome Assembly v1.0 & Annotation v1 (v1.0.a1)