NZ23g4, NZ23g4 (genetic_marker) Malus x domestica

Marker Overview
NameNZ23g4
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(ga)19
Primer 1NZ23g4.forward primer: tttctctctctttcccaactc
Primer 2NZ23g4.reverse primer: agc cgc ctt gca tta aat ac
Product Length88
Publication[view all]
ContactP. Guilford
Contact
NameDetails
P. Guilford
First name:P.
Last name:Guilford
Institution:Horticulture and Food Research Institute of New Zealand
Address:Horticulture and Food Research Institute of New Zealand, Mt Albert Research Centre, Private Bag 92 169, Auckland, New Zealand
Country:New Zealand
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerNZ23g4.forward primerMalus x domesticaprimer
reverse primerNZ23g4.reverse primerMalus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
NZ23g4NZ23g4-8.5Malus x domesticamarker_locus
NZ23g4NZ23g4Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-JM7xS63-F1J6N/A8.5NZ23g4View
2Apple-RGTxGD-F1-2015RGT_15N/A52.38NZ23g4View