Mdo_FHT, Mdo_FHT (genetic_marker) Malus x domestica | GDR

Marker Overview

Marker Overview


Name	Mdo_FHT
Genbank ID	N/A
Type	candidate gene marker
Species	Malus x domestica
Primer 1	Mdo_FHT.forward primer: GCGTGATTGGCTACGTGTAA
Primer 2	Mdo_FHT.reverse primer: TCGATTCGACTCTCGCACTA
Product Length	169
Publication	[view all]
Contact	Cindy F. Verdu

Contact

Name

Details

Cindy F. Verdu

First name:	Cindy
Last name:	Verdu
Title:	Researcher
Institution:	INRA
Address:	INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:	France
Email:	cindyverdu@gmail.com

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Chr01	chromosome	Chr01:31845407..31845574 .	Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation	GDR marker alignment to genome using primer sequences
chr1A	chromosome	chr1A:32987891..32988068 .	Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation	GDR marker alignment to genome using primer sequences

Publications


Year	Publication
2014	Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Apple-X5210X8402-F1-Consensus	LG1	N/A	56.9	FHT	View