NH037a, NH037a (genetic_marker) Pyrus pyrifolia | GDR

Marker Overview

Marker Overview


Name	NH037a
Genbank ID	N/A
Type	SSR
Species	Pyrus pyrifolia
Repeat Motif	(AG)3TG(AG)4.5
Primer 1	NH037a.forward primer: AAGAGGAGTGTGAGAATGACCCAA
Primer 2	NH037a.reverse primer: ATGGGCTTGGTCAGGTGGAT
Publication	[view all]
Contact	Yutaka Sawamura

Contact

Name

Details

Yutaka Sawamura

First name:	Yutaka
Last name:	Sawamura
Institution:	Institute of Fruit Tree and Tea Science
Address:	Institute of Fruit Tree and Tea Science, NARO, Tsukuba 305-8605, Japan
Country:	Japan
Email:	ysawa@affrc.go.jp

Publications


Year	Publication
2004	Sawamura Y, Saito T, Takada N, Yamamoto T, Kimura T, Hayashi T,, Kotobuki K. Identification of Parentage of Japanese Pear 'Housui'. Journal of the Japanese Society for Horticultural Science 2004 73(6):511-518

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pear-BD-F1-2015	LG3	N/A	67.4	NH037a	View
2	Pear-Bayuehong-F1-2015	LG3	N/A	67.45	NH037a	View
3	Pear-Dangshansuli-F1-2015	LG3	N/A	67.32	NH037a	View
4	Pear-integrated_consensus_map-IPCG-2017	LG3	N/A	184.55	NH037a	View