|
Marker Overview
Name | AX-123357718 |
dbSNP ID | N/A |
SNP Array ID | 50K SNP array for cultivated strawberry: | Affx-88841846 | 850K SNP array for cultivated strawberry: | Affx-88841846 | 35K SNP array for cultivated strawberry: | Affx-88841846 |
|
Type | SNP |
SNP Alleles | T/G |
5' Flanking Sequence | GCAGCAGCCATTGTGATGAGGACTGTTCGTAATAC |
3' Flanking Sequence | GTTGATACAGGAAGAACGGTGGTCTGCACTATCCA |
Species | Fragaria x ananassa |
Publication | [view all] |
Contact | S Verma
|
Publications
Year | Publication |
2020 | Hardigan Michael A., Feldmann Mitchell J., Lorant Anne, Bird Kevin A., Famula Randi, Acharya Charlotte, Cole Glenn, Edger Patrick P., Knapp Steven J. Genome Synteny Has Been Conserved Among the Octoploid Progenitors of Cultivated Strawberry Over Millions of Years of Evolution. Front. Plant Sci., 2020 February 7; 10:1789 | https://doi.org/10.3389/fpls.2019.01789 |
2018 | Pincot DDA, Poorten TJ, Hardigan MA, Harshman JM, Acharya CB, Cole GS, Gordon TR, Stueven M, Edger PP, Knapp SJ. Genome-Wide Association Mapping Uncovers Fw1, a Dominant Gene Conferring Resistance to Fusarium Wilt in Strawberry. G3 (Bethesda). 2018 Mar 30; 8(5):1817-1828. |
2017 | Verma S, Bassil NV, van de Weg E, Harrison RJ, Monfort A, Hidalgo JM, Amaya I, Denoyes B, Mahoney L, Davis TM, Fan Z, Knapp S, Whitaker VM. Development and evaluation of the Axiom IStraw35 384HT array for the allo-octoploid cultivated strawberry Fragaria x ananassa. Acta Hortic. (1156): 75–82. 10.17660/ActaHortic.2017.1156.10. |
Sequence
>AX-123357718 ID=AX-123357718; Name=AX-123357718; organism=Fragaria x ananassa; type=genetic_marker; length=71bp GCAGCAGCCATTGTGATGAGGACTGTTCGTAATACKGTTGATACAGGAAG AACGGTGGTCTGCACTATCCA
|