CH02D12 (genetic_marker) Malus domestica

Marker Overview
NameCH02D12
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat Motif(GA)19
PCR Condition
94 °C for 5 min, 35x (94 °C for 60 s, 55 °C for 60 s, 72 °C for 60 s), 72°C for 10 min
Primer 1CH02D12.F: AACCAGATTTGCTTGCCATC
Primer 2CH02D12.R: GCTGGTGGTAAACGTGGTG
Primer 3CH02d12-Forward: AACCAGATTTGCTTGCCATC
Primer 4CH02d12-Reverse: GCTGGTGGTAAACGTGGTG
Product Length177-199
244-245
Max Length245
PolymorphismP_ CH02D12
Publication[view all]
ContactC. Gessler
Miyuki Kunihisa
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
FCH02D12.FMalus x domesticaprimer
RCH02D12.RMalus x domesticaprimer
CH02d12-ReverseMalus x domesticaprimer
CH02d12-ForwardMalus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit shapeqFRSH.JGD-J11.2008.2Malus x domesticaQTL
fruit shapeqFRSH.JGD-J11.2009Malus x domesticaQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
unbranched upper zone of trunkqUZTR.SG-ch11Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH02d12_SGCH02d12_SGMalus x domesticamarker_locus
CH02d12CH02d12Malus x domesticamarker_locus
CH02D12CH02D12-21.7Malus x domesticamarker_locus
CH02D12CH02D12-17Malus x domesticamarker_locus
CH02D12CH02D12-57.9Malus x domesticamarker_locus
CH02D12CH02D12-58.019Malus x domesticamarker_locus
CH02D12CH02D12-154.7Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-SG-F111N/A26.9CH02d12_SGView
2Apple-FD-F1-2006F11N/A23.6CH02d12View
3Apple-PF-F1-2012ch11N/A21CH02d12View
4Apple-OA-F1-OrinOR11N/A28.9CH02d12View
5Apple-GDxJ-F1-2012LG11N/A63.7CH02d12View
6Apple-JGD-F1-2014J11N/A7.4CH02d12View
7Apple-JGD-F1-2014G11N/A5.8CH02d12View
8Apple-RGTxGD-F1-2015GD_11N/A33.48CH02d12View
9Apple-JM7xS63-F1J11N/A21.7CH02D12View
10Apple-JM7xS63-F1S11N/A17CH02D12View
11Pear-BD-F1-2015LG11N/A57.9CH02D12View
12Pear-Bayuehong-F1-2015LG11N/A58.02CH02D12View
13Pear-integrated_consensus_map-IPCG-2017LG11N/A154.7CH02D12View