|
Marker Overview
Name | RosBREEDSNP_SNP_AG_27159165_Lg14_01473_MAF50_1646914_exon1 |
dbSNP ID | ss475881144 |
SNP Array ID | 480K SNP array for apple: | AX-115181821 | IRSC 9K SNP array for apple: | RosBREEDSNP_SNP_AG_27159165_Lg14_01473_MAF50_1646914_exon1 |
|
Type | SNP |
SNP Alleles | R |
Species | Malus x domestica |
Publication | [view all] |
Analyses
This genetic_marker is derived from or has results from the following analyses
Publications
Year | Publication |
2012 | Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203. |
2016 | Bianco L, Cestaro A, Linsmith G, Muranty H, Denance C, Théron A, Poncet C, Micheletti D, Kerschbamer E, Di Pierro EA, Larger S, Pindo M, van de Weg E, Davassi A, Laurens F, Velasco R, Durel CE, Troggio M. Development and validation of the Axiom(®) Apple480K SNP genotyping array. The Plant journal : for cell and molecular biology. 2016 Feb 26. |
Sequence
>RosBREEDSNP_SNP_AG_27159165_Lg14_01473_MAF50_1646914_exon1 ID=RosBREEDSNP_SNP_AG_27159165_Lg14_01473_MAF50_1646914_exon1; Name=RosBREEDSNP_SNP_AG_27159165_Lg14_01473_MAF50_1646914_exon1; organism=Malus x domestica; type=genetic_marker; length=75bp TGCTTCTCCTAATTCTTCCTCCCTCTTCCTCTTTG[A/G]CAGAGACAAG GAAGATATGGTTTTGGCCGACACCA
|