|
Marker Overview
Name | NH017a |
Genbank ID | N/A |
Type | SSR |
Species | Pyrus pyrifolia |
Repeat Motif | (GA)14 |
PCR Condition | 55 |
Primer 1 | NH017a.forward primer: CAGAAAGGAGAGGGCTACAG |
Primer 2 | NH017a.reverse primer: CCCTCACCCAATCAAAACTC |
Product Length | 101 |
Publication | [view all] |
Contact | Toshiya Yamamoto
|
Publications
Year | Publication |
2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
2002 | Yamamoto T, Kimura T, Shoda M, Ban Y, Hayashi T, Matsuta N. Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Molecular Ecology Notes. 2002 Mar; 2(1):14-16. |
|