NH017a, NH017a (genetic_marker) Pyrus sp. | GDR

Marker Overview

Marker Overview


Name	NH017a
Genbank ID	N/A
Type	SSR
Species	Pyrus pyrifolia
Repeat Motif	(GA)14
PCR Condition	55
Primer 1	NH017a.forward primer: CAGAAAGGAGAGGGCTACAG
Primer 2	NH017a.reverse primer: CCCTCACCCAATCAAAACTC
Product Length	101
Publication	[view all]
Contact	Toshiya Yamamoto

Contact

Name

Details

Toshiya Yamamoto

First name:	Toshiya
Last name:	Yamamoto
Institution:	National Institute of Fruit Tree Science, Graduate School of Life and Environmental Sciences, University of Tsukuba
Address:	National Institute of Fruit Tree Science, 2-1 Fujimoto, Tsukuba, Ibaraki 305-8605, Japan
Country:	Japan
Email:	toshiya@affrc.go.jp
Last update:	Apr 2014

Publications


Year	Publication
2004	Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56.
2002	Yamamoto T, Kimura T, Shoda M, Ban Y, Hayashi T, Matsuta N. Development of microsatellite markers in the Japanese pear (Pyrus pyrifolia Nakai). Molecular Ecology Notes. 2002 Mar; 2(1):14-16.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Pear-BD-F1-2015	LG10	N/A	32.9	NH017a	View
2	Pear-Bayuehong-F1-2015	LG10	N/A	38.73	NH017a	View
3	Pear-Dangshansuli-F1-2015	LG10	N/A	5.13	NH017a	View
4	Pear-integrated_consensus_map-IPCG-2017	LG10	N/A	78.26	NH017a	View