|
Marker Overview
Name | Hi15h12 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | GAT |
PCR Condition | annealing temp 60 degree |
Primer 1 | Hi15h12.primer 1: GAACAAGAAGGACGCGAATC |
Primer 2 | Hi15h12.primer 2: GTTTGGGCCTCGTTATCACTACCA |
Product Length | 222-228 |
Polymorphism | P_ Hi15h12 |
Publication | [view all] |
Contact | A. Patocchi Miyuki Kunihisa
|
Alignments
The following features are aligned
Publications
Year | Publication |
2006 | Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224. |
2014 | Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51. |
|