|
Marker Overview
Name | TsuENH086 |
Genbank ID | N/A |
Type | SSR |
Species | Pyrus pyrifolia |
Primer 1 | TsuENH086.forward primer: ctctgttctgcttcgattctgct |
Primer 2 | TsuENH086.reverse primer: gtccacgttcaccatttttcagt |
Product Length | 172 |
Max Length | 183 bp |
Publication | [view all] |
Contact | Shingo Terakami
|
Publications
Year | Publication |
2009 | Nishitani C, Terakami S, Sawamura Y, Takada N, Yamamoto T. Development of novel EST-SSR markers derived from Japanese pear (Pyrus pyrifolia). Breeding Science. 2009; 59(4):391-400. |
2009 | Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107. |
2009 | Terakami S, Kimura T, Nishitani C, Sawamura Y, Saito T, Hirabayashi T, Yamamoto T. Genetic Linkage Map of the Japanese Pear ‘Housui’ Identifying Three Homozygous Genomic Regions. 2009 J. Japan. Soc. Hort. Sci. 78 (4): 417–424. |
|