EPPCU1106, EPPCU1106 (genetic_marker) Prunus persica

Marker Overview
NameEPPCU1106
Genbank IDBU041106
TypeEST-SSR
SpeciesPrunus persica
Source TypeEST
PCR Condition94 C 2 min, 94 C 25 sec, 60 C 20 sec, 72 C 20 sec. 35 cycles, 72 C 5min
Primer 1EPPCU1106.F primer: CGAAGCTGAATCGAGATTATGA
Primer 2EPPCU1106.R primer: CCGAAACACAATACTCTTGCAT
Product Length199
Publication[view all]
ContactP. Arus
Contact
NameDetails
P. Arus
First name:Pere
Last name:Arus
Institution:IRTA
Address:Institut de Recerca I Tecnologia Agroalimentaries (IRTA), Departament de Genetica Vegetal, Carretera de Cabrils s/n, 08348 Cabrils, Spain
Email:pere.arus@irta.es
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
R primerEPPCU1106.R primerPrunus persicaprimer
F primerEPPCU1106.F primerPrunus persicaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
EPPCU1106EPPCU1106Prunus persicamarker_locus
EPPCU1106EPPCU1106-37.25Prunus persicamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Markers Database2004-01-01
Alignment of genetic markers to Prunus persics v2.02019-04-11
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Prunus Bin MapLG4N/A34.1EPPCU1106View
2Prunus-TE-F2-20154N/A27.3EPPCU1106View
3Peach_CxEL_F1CxEL4N/A39.8EPPCU1106View
4Prunus-TxE-peachV2.0LG4N/A34.1EPPCU1106View
5Sweet Cherry-C-303xBeniyutaka-F1Pa4N/A38.34EPPCU1106View
6Sweet Cherry-C-303xBenikirari-F1Pa4N/A36.05EPPCU1106View
7Sweet Cherry-PAV_r1.0_consensus_map-F1Pa4N/A76.43EPPCU1106View
8Peach_Consensus_map_20184N/A37.25EPPCU1106View
Alignments
Feature NameTypeLocationAnalysis
scaffold_4 supercontig scaffold_4:9586223..9588103. Prunus persica Whole Genome v1.0 Assembly & Annotation
Pp04 chromosome Pp04:9597208..9599088+ Prunus persica Whole Genome Assembly v2.0 & Annotation v2.1 (v2.0.a1)