|
Marker Overview
Name | M9a |
Genbank ID | N/A |
Type | SSR |
Species | Prunus persica |
Germplasm | Akatsuki |
Source Type | cDNA |
Repeat Motif | (AG)4(GC)3(AG)8 |
Primer 1 | M9a.F primer: GCCGAAACCCTAGGTGAGCG |
Primer 2 | M9a.R primer: CAGGATGCTTGCGGTGCTTG |
Product Length | 138 |
Publication | [view all] |
Contact | T. Yamamoto
|
Publications
Year | Publication |
2002 | Yamamoto T, Mochida K, Imai T, Shi Y.Z, Ogiwara I, Hayashi T. Microsatellite markers in peach [Prunus persica (L.) Batsch] derived from an enriched genomic and cDNA libraries. Molecular Ecology Notes. 2002; 2(3):298-301. |
2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
|