GDsnp02800, GDsnp02800 (genetic_marker) Malus x domestica

Marker Overview
NameGDsnp02800
Aliasss475882361
rs267615306
GD_SNP02800
GD_SNP02800_M
b475882361
AX-105213465
dbSNP IDss475882361
SNP Array ID
IRSC 9K SNP array for apple:GDsnp02800
50K SNP array for apple:GDsnp02800
TypeSNP
SNP AllelesA/G
5' Flanking SequenceATTGGATGTAATGTCCTTGGTTAGC
3' Flanking SequenceAAGATCAACACGAAGACTAAATGCC
SpeciesMalus x domestica
Publication[view all]
ContactCindy F. Verdu
Publications
YearPublication
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2012Chagné D, Crowhurst RN, Troggio M, Davey MW, Gilmore B, Lawley C, Vanderzande S, Hellens RP, Kumar S, Cestaro A, Velasco R, Main D, Rees JD, Iezzoni A, Mockler T, Wilhelm L, Van de Weg E, Gardiner SE, Bassil N, Peace C. Genome-wide SNP detection, validation, and development of an 8K SNP array for apple. PloS one. 2012; 7(2):e31745.
2013Troggio M, Surbanovski N, Bianco L, Moretto M, Giongo L, Banchi E, Viola R, Fernández FF, Costa F, Velasco R, Cestaro A, Sargent DJ. Evaluation of SNP Data from the Malus Infinium Array Identifies Challenges for Genetic Analysis of Complex Genomes of Polyploid Origin. PloS one. 2013; 8(6):e67407.
2014Verdu CF, Guyot S, Childebrand N, Bahut M, Celton J-M, Gaillard S, Lasserre-Zuber P, Troggio M, Guilet D, Laurens F. QTL Analysis and Candidate Gene Mapping for the Polyphenol Content in Cider Apple. PLoS ONE. 2014; 9(10):e107103.
2020Rymenants M, van de Weg E, Auwerkerken A, De Wit I, Czech A, Nijland B, Heuven H, De Storme N, and Keulemans W. Detection of QTL for apple fruit acidity and sweetness using sensorial evaluation in multiple pedigreed full-sib families. Tree Genetics & Genomes 16, 71 (2020). https://doi.org/10.1007/s11295-020-01466-8
Contact
NameDetails
Cindy F. Verdu
First name:Cindy
Last name:Verdu
Title:Researcher
Institution:INRA
Address:INRA, UMR1345 Institut de Recherche en Horticulture et Semences, Beaucouze, France
Country:France
Email:cindyverdu@gmail.com
Libraries
Library NameType
IRSC 9K SNP array for appleSNP_chip
50K SNP array for appleSNP_chip
Relationships

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
fruit firmnessqFRFRM.XX-ch11.1Malus x domesticaQTL
fruit juicinessqFRJUC.XX-ch11.1Malus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GDsnp02800GDsnp02800Malus x domesticamarker_locus
GD_SNP02800GD_SNP02800Malus x domesticamarker_locus
GDsnp02800GDsnp02800-48.187Malus x domesticamarker_locus


Analyses
This genetic_marker is derived from or has results from the following analyses
Analysis NameDate Performed
RosBREED SNP development2011-01-01
Sequence
>GDsnp02800 ID=GDsnp02800|Name=GDsnp02800|organism=Malus x domestica|type=genetic_marker|length=201bp
TTTGAAATTAAATTTCTTTTTATCTTAATTGAAAAATATAATGGGTTATA
ATATTTTTATGAATTTTTAACAGAAATTGGATGTAATGTCCTTGGTTAGC
RAAGATCAACACGAAGACTAAATGCCAAATAAAATACATAGAGACTAAAT
TGGCCAAATGACTATAACACATCGACCATTTTGACATTAAGCGAAAATTA
T
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map11N/A50.4GDsnp02800View
2Apple-M432-201311N/A54.5GDsnp02800View
3Apple-M432-2013-physical-Malus-domestica11N/A28409419GDsnp02800View
4Apple-B-F1-2014B11N/A49GDsnp02800View
5Apple-X3259X3263-F111N/A56.48GD_SNP02800View
6Apple-X5210X8402-F1-X8402LG11N/A70GD_SNP02800View
7Apple-GDxBr-F1-2013LG11N/A53.61GD_SNP02800View
8Apple-Honeycrisp_Consensus-F111N/A48.19GDsnp02800View
Alignments
Feature NameTypeLocationAnalysis
MDC019097.322 contig MDC019097.322:5417..5417. Malus x domestica Whole Genome v1.0 Assembly & Annotation
Chr11 chromosome Chr11:32337404..32337504+ Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr11 chromosome Chr11:32337461..32337461. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
Chr11 chromosome Chr11:32337454..32337454. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation