|
Marker Overview
Name | NZ05g8 |
Genbank ID | N/A |
Type | SSR |
Species | Malus x domestica |
Repeat Motif | (ga)18 |
Primer 1 | NZ05g8.forward primer: cggccatcgattatcttactctt |
Primer 2 | NZ05g8.reverse primer: gga tca atg cac tga aat aaa cg |
Product Length | 121 |
Publication | [view all] |
Contact | P. Guilford
|
Publications
Year | Publication |
2004 | Yamamoto T, Kimura T, Saito T, Kotobuki K, Matsuta N, Liebhard R, Gessler C, Weg W.E. van de, Hayashi, T. Genetic linkage maps of Japanese and European pears aligned to the apple consensus map. Acta Horticulturae. 2004; 663:51-56. |
1997 | Guilford P, Prakash S, Zhu JM, Rikkerink E, Gardiner S, Bassett H, Forster R. Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultivar identification. Theoretical and Applied Genetics. 1997; 94(2):249-254. |
|