CH04c10, CH04c10 (genetic_marker) Malus x domestica

Marker Overview
NameCH04c10
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH04c10.primer 1: GGGTTAGGTTGTCTTCTCTCCT
Primer 2CH04c10.primer 2: GCTTCTCGGGTGAGTTTTTC
Product Length133-180
133–180
Max Length145 bp
PolymorphismP_ CH04c10
Publication[view all]
ContactC. Gessler
Zhen Han
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH04c10.primer 1Malus x domesticaprimer
primer 2CH04c10.primer 2Malus x domesticaprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH04c10CH04c10Malus x domesticamarker_locus
CH04c10CH04c10-2.5Malus x domesticamarker_locus
CH04c10CH04c10-6.9Malus x domesticamarker_locus
CH04c10CH04c10-33.2Malus x domesticamarker_locus
CH04c10CH04c10-32.414Malus x domesticamarker_locus
CH04c10CH04c10-33.179Malus x domesticamarker_locus
CH04c10CH04c10-35.35Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-C16xC17-F1-201217N/A12.99CH04c10View
2Pear-PM-F1-PEAR317N/A7.21CH04c10View
3Pear-PM-F1-Moonglow17N/A0CH04c10View
4Apple-PF-F1-2012ch17N/A1CH04c10View
5Apple-JGD-F1-FRRJ17N/A27.5CH04c10View
6Apple-GDxJ-F1-2012LG17.1N/A27.3CH04c10View
7Pear-Ba-F1-2013Ba17N/A0CH04c10View
8Apple-JM7xS63-F1J17N/A2.5CH04c10View
9Apple-JM7xS63-F1J17N/A2.5CH04c10View
10Apple-JM7xS63-F1S17N/A6.9CH04c10View
11Pear-BD-F1-2015LG17N/A33.2CH04c10View
12Pear-Bayuehong-F1-2015LG17N/A32.41CH04c10View
13Pear-Dangshansuli-F1-2015LG17N/A33.18CH04c10View
14Pear-integrated_consensus_map-IPCG-2017LG17N/A35.35CH04c10View
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Zhen Han
First name:Zhen
Last name:Han
Institution:Institute for Horticultural Plants, China Agricultural University
Address:Beijing 100193, China
Country:China
Email:rschan@cau.edu.cn
Keywords:apple