|
Marker Overview
Name | s5_14546765 |
dbSNP ID | N/A |
SNP Array ID | Cherry 6+9K SNP array: | s5_14546765 |
|
Type | SNP |
SNP Alleles | A/G |
5' Flanking Sequence | CTGCAAAACACCCTAAAAAGGCAAGTACGGGACTAACCGGGAGAAGTTCCGGGAGTTAT |
3' Flanking Sequence | AAGT |
Species | Prunus avium |
Publication | [view all] |
Contact | Patricio Hinrichsen Stijn Vanderzande
|
Comment | sweet cherry SNPs identified by GBS from Guajardo et al (2015), unmapped - intergenic SNPs |
Alignments
The following features are aligned
Publications
Year | Publication |
2015 | Guajardo V, Solís S, Sagredo B, Gainza F, Muñoz C, Gasic K, Hinrichsen P. Construction of high density sweet cherry (Prunus avium L.) linkage maps using microsatellite markers and SNPs detected by genotyping-by-sequencing (GBS). PLoS ONE 2015. |
2020 | Vanderzande S, Zheng P, Cai L, Barac G, Gasic K, Main D, Iezzoni A and Peace C. The cherry 6+9K SNP array: a cost-effective improvement to the cherry 6K SNP array for genetic studies. Scientific Reports 10, 7613 (2020). https://doi.org/10.1038/s41598-020-64438-x |
Sequence
>s5_14546765 ID=s5_14546765; Name=s5_14546765; organism=Prunus avium; type=genetic_marker; length=64bp CTGCAAAACACCCTAAAAAGGCAAGTACGGGACTAACCGGGAGAAGTTCC GGGAGTTATRAAGT
|