CH05g07, CH05g07 (genetic_marker) Malus x domestica

Marker Overview
NameCH05g07
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH05g07.primer 1: CCCAAGCAATATAGTGAATCTCAA
Primer 2CH05g07.primer 2: TTCATCTCCTGCTGCAAATAAC
Product Length149-197
PolymorphismP_ CH05g07
Publication[view all]
ContactC. Gessler
Andreas Peil
R. Liebhard
Publications
YearPublication
2009Celton J-M, Tustin DS, Chagne D, Gardiner SE. Construction of a dense genetic linkage map for apple rootstocks using SSRs developed from Malus ESTs and Pyrus genomic sequences. Tree Genetics and Genomes. 2009; 5(1):93-107.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2012Antanaviciute L, Fernández-Fernández F, Jansen J, Banchi E, Evans KM, Viola R, Velasco R, Dunwell JM, Troggio M, Sargent DJ. Development of a dense SNP-based linkage map of an apple rootstock progeny using the Malus Infinium whole genome genotyping array. BMC genomics. 2012; 13:203.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
R. Liebhard
First name:R.
Last name:Liebhard
Institution:Swiss Federal Institute of Technology
Address:Swiss Federal Institute of Technology, Institute of Plant Science / Phytopathology, Universitätstrasse 2, 8092 Zurich, Switzerland
Country:Switzerland
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
primer 1CH05g07.primer 1Malus x domesticaprimer
primer 2CH05g07.primer 2Malus x domesticaprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
phenolic compound contentqPHE.X5210X8402-LG14.J010.4CaffeoylquinicAcidMalus x domesticaQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
CH05g07CH05g07Malus x domesticamarker_locus
CH05g07yCH05g07yMalus x domesticamarker_locus
CH05g07zCH05g07zMalus x domesticamarker_locus
CH05g07.yCH05g07.yMalus x domesticamarker_locus
CH05g07.zCH05g07.zMalus x domesticamarker_locus
CH05g07CH05g07-13Malus x domesticamarker_locus
CH05g07CH05g07-15.2Malus x domesticamarker_locus
CH05g07CH05g07-37.1Malus x domesticamarker_locus
CH05g07CH05g07-40.704Malus x domesticamarker_locus
CH05g07CH05g07-40.236Malus x domesticamarker_locus
CH05g07CH05g07-108.39Malus x domesticamarker_locus
CH05g07CH05g07-44.25Malus x domesticamarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple-IM-F1-IdaredIda LG 14N/A17.8CH05g07View
2Apple-MAL0045_x_Idared-F1-MfuscaLG14N/A27.7CH05g07View
3Apple-X3259X3263-F112N/A20.02CH05g07View
4Apple-X3259X3263-F114N/A15.75CH05g07View
5Apple-X5210X8402-F1-ConsensusLG14N/A13.8CH05g07View
6Apple-X5210X8402-F1-X5210LG14N/A24.6CH05g07View
7Apple-X5210X8402-F1-X8402LG14N/A0CH05g07View
8Apple-JGxWSH-F1LG12N/A11.5CH05g07View
9Apple-WSH-F1LG12N/A8CH05g07View
10Pear-BD-F1-2014-geneticLG14N/A18.8CH05g07View
11Pear-Bartlett-F1-2007Ba12N/A13.7CH05g07View
12Pear-Bartlett-F1-2007Ba14N/A15.5CH05g07View
13Pear-La_France-F1-2007La12N/A19CH05g07View
14Pear-La_France-F1-2007La14N/A11.4CH05g07View
15Apple-FD-F1-2006D12N/A30.9CH05g07yView
16Apple-FD-F1-2006F12N/A31.5CH05g07yView
17Apple Integrated map12N/A18.2CH05g07yView
18Apple-IM-F1-IdaredIda LG 12N/A19.3CH05g07yView
19Apple-IM-F1-Mr5Mr5 LG 12N/A14.7CH05g07yView
20Apple-RGxPI6-F1LG14N/A24CH05g07yView
21Apple Integrated map14N/A14.6CH05g07zView
22Apple-FD-F1-2006F14N/A8.2CH05g07zView
23Apple-FD-F1-2006D14aN/A8CH05g07zView
24Apple-IM-F1-Mr5Mr5 LG 14N/A14.6CH05g07zView
25Apple-FD-Discovery-F1-2003D14N/A8.1CH05g07zView
26Apple-MM-F112N/A13.4CH05g07.yView
27Apple-M432-2012LG12N/A14.7CH05g07.yView
28Apple-MM-F114N/A20.6CH05g07.zView
29Apple-M432-2012LG14N/A2CH05g07.zView
30Pear-Ba-F1-2013Ba12N/A13CH05g07View
31Pear-Ba-F1-2013Ba14N/A15.2CH05g07View
32Pear-BD-F1-2015LG14N/A37.1CH05g07View
33Pear-Bayuehong-F1-2015LG14N/A40.7CH05g07View
34Pear-Dangshansuli-F1-2015LG14N/A40.24CH05g07View
35Pear-integrated_consensus_map-IPCG-2017LG12N/A108.39CH05g07View
36Pear-integrated_consensus_map-IPCG-2017LG14N/A44.25CH05g07View