CH04c07, CH04c07 (genetic_marker) Malus x domestica

Marker Overview
NameCH04c07
Genbank IDN/A
TypeSSR
SpeciesMalus x domestica
Repeat MotifGA
PCR Conditionannealing temp 60 degree
Primer 1CH04c07.primer 1: GGCCTTCCATGTCTCAGAAG
Primer 2CH04c07.primer 2: CCTCATGCCCTCCACTAACA
Product Length98-135
PolymorphismP_ CH04c07
Publication[view all]
ContactC. Gessler
Andreas Peil
Miyuki Kunihisa
Contact
NameDetails
C. Gessler
First name:Cesare
Last name:Gessler
Institution:ETH Zurich
Address:ZTH Zurich Institut f. Integrative Biologie LFW C 15 Universitatstrasse 2 8092 Zurich
Country:Switzerland
Email:cesare.gessler@agrl.ethz.ch
Phone:+41 44 632 38 71
Fax:+41 (0) 632 11 08
Last update:May 2002
Andreas Peil
First name:Andreas
Last name:Peil
Title:Researcher
Institution:Institute for Breeding Research on Fruit
Address:Kulius Kuhn-Institut (JKI), Pillnitzer Platz 3a, 01326
Country:Dresden, Germany
Email:andreas.peil@jki.bund.de
Miyuki Kunihisa
First name:Miyuki
Last name:Kunihisa
Institution:NARO Institute of Fruit Tree Science
Address:2-1 Fujimoto, Tsukuba, Ibaraki 305-8605
Country:Japan
Email:miyuky@affrc.go.jp
Phone:81-29-838-6437
Keywords:fruit drop
Publications
YearPublication
2006Silfverberg-Dilworth E, Matasci CL, Van de Weg WE, Van Kaauwen MPW, Walser M, Kodde LP, Soglio V, Gianfranceschi L, Durel CE, Costa F, Yamamoto T, Koller B, Gessler C Patocchi A. Microsatellite markers spanning the apple (Malus x domestica Borkh.) genome. Tree Genetics and Genomes. 2006; 2(4):202-224.
2010Velasco R, Zharkikh A, Affourtit J, Dhingra A, Cestaro A, Kalyanaraman A, Fontana P, Bhatnagar SK, Troggio M, Pruss D, Salvi S, Pindo M, Baldi P, Castelletti S, Cavaiuolo M, Coppola G, Costa F, Cova V, Dal Ri A, Goremykin V, Komjanc M, Longhi S, Magnago P, Malacarne G, Malnoy M, Micheletti D, Moretto M, Perazzolli M, Si-Ammour A, Vezzulli S, Zini E, Eldredge G, Fitzgerald LM, Gutin N, Lanchbury J, Macalma T, Mitchell JT, Reid J, Wardell B, Kodira C, Chen Z, Desany B, Niazi F, Palmer M, Koepke T, Jiwan D, Schaeffer S, Krishnan V, Wu C, Chu VT, King ST, Vick J, Tao Q, Mraz A, Stormo A, Stormo K, Bogden R, Ederle D, Stella A, Vecchietti A, Kater MM, Masiero S, Lasserre P, Lespinasse Y, Allan AC, Bus V, Chagné D, Crowhurst RN, Gleave AP, Lavezzo E, Fawcett JA, Proost S, Rouzé P, Sterck L, Toppo S, Lazzari B, Hellens RP, Durel CE, Gutin A, Bumgarner RE, Gardiner SE, Skolnick M, Egholm M, Van de Peer Y, Salamini F, Viola R. The genome of the domesticated apple (Malus x domestica Borkh.). Nature Genetics. 2010 Oct; 42(10):833-839.
2002Liebhard, R., Gianfranceschi, L., Koller, B., Ryder, C.D., Tarchini, R., Weg, E. van de., Gessler, C. Development and characterisation of 140 new microsatellites in apple (Malus x domestica Borkh.) Mol. breed. 2002. v. 10 (4) p. 217-241.
2014Wöhner TW, Flachowsky H, Richter K, Garcia-Libreros T, Trognitz F, Hanke M, Peil A. QTL mapping of fire blight resistance in Malus ×robusta 5 after inoculation with different strains of Erwinia amylovora. Molecular breeding. 2014; 34(1):217-230.
2014Emeriewen O, Richter K, Kilian A, Zini E, Hanke M, Malnoy M, Peil A. Identification of a major quantitative trait locus for resistance to fire blight in the wild apple species Malus fusca. Molecular breeding. 2014; 34(2):407-419.
2012Schouten HJ, van de Weg WE, Carling J, Khan SI, McKay SJ, van Kaauwen MPW, Wittenberg AHJ, Koehorst-van Putten HJJ, Noordijk Y, Gao Z, Rees DJG, Van Dyk MM, Jaccoud D, Considine MJ, Kilian A. Diversity arrays technology (DArT) markers in apple for genetic linkage maps. Molecular breeding 2012 29:645–660
2014Kunihisa M, Moriya S, Abe K, Okada K, Haji T, Hayashi T, Kim H, Nishitani C, Terakami S, Yamamoto T. Identification of QTLs for fruit quality traits in Japanese apples: QTLs for early ripening are tightly related to preharvest fruit drop. Breeding science. 2014 Sep; 64(3):240-51.
2015Ben Sadok I, Tiecher A, Galvez-Lopez D, Lahaye M, Lasserre-Zuber P, Bruneau M, Hanteville S, Robic R, Cournol R, Laurens F. Apple fruit texture QTLs: year and cold storage effects on sensory and instrumental traits. Tree Genetics & Genomes 2015 11:119
2004Plant Breeding, 123(4):321
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Apple Integrated map14N/A37.7CH04c07View
2Apple-FD-F1-2006F14N/A31.6CH04c07View
3Apple-FD-F1-2006D14aN/A18.9CH04c07View
4Apple-IM-F1-IdaredIda LG 14N/A44.3CH04c07View
5Apple-IM-F1-Mr5Mr5 LG 14N/A29.3CH04c07View
6Apple-MAL0045_x_Idared-F1-MfuscaLG14N/A35.8CH04c07View
7Apple-PF-F1-2012ch9N/A34CH04c07View
8Apple-OA-F1-OrinOR14N/A45.2CH04c07View
9Apple-OA-F1-AkaneAK14N/A9.6CH04c07View
10Apple-X3259X3263-F114N/A44.12CH04c07View
11Apple-RGTxGD-F1-2015RGT_14N/A36.69CH04c07View
12Apple-RGTxGD-F1-2015GD_14N/A53.22CH04c07View
13Apple-RGxPI6-F1LG14N/A47.9CH04c07View
14Apple-X5210X8402-F1-ConsensusLG14N/A39CH04c07View
15Apple-X5210X8402-F1-X5210LG14N/A48.7CH04c07View
16Apple-X5210X8402-F1-X8402LG14N/A36.8CH04c07View
17Pear-BD-F1-2014-geneticLG14N/A75.7CH04c07View
18Pear-Bartlett-F1-2007Ba14N/A42.3CH04c07View
19Pear-La_France-F1-2007La14N/A40.6CH04c07View
20Apple-FD-Discovery-F1-2003D14N/A18.6CH04c07View
21Pear-Ba-F1-2013Ba14N/A41.8CH04c07View
22Pear-integrated_consensus_map-IPCG-2017LG14N/A117.88CH04c07View
Alignments
Feature NameTypeLocationAnalysis
Chr14 chromosome Chr14:24166454..24166567. Malus x domestica GDDH13 v1.1 Whole Genome Assembly & Annotation
chr14A chromosome chr14A:23560576..23560683. Malus x domestica ‘Honeycrisp’ Genome v1.1.a1 Assembly & Annotation